TRIM16 EBBRHf GGCGTAGAGTATGATACCATG EBBRHr TCCCATCACTGTAGCTGGCAA PCR product 113 bp Designed on sequence PCR RUNNING CONDITIONS 95¡C x 10' 95¡C x 1' 50¡C x 1' 72¡C x 1' 35 cycles NAME Chromosomal Assignment and Placement(s) ---- --------------------------------------- trim16 Chromosome Chr17 Places -47.32 cR from WI-9674 Places 33.97 cR from AFMA126YD5 (lod 2.35 relative to most likely) 110110011011000100111100001011110010000001101111011010110001111000101111111111001110101100001